pet28 expression vector (Millipore)
Millipore is a verified supplier 
90
Structured Review
Millipore
pet28 expression vector
Pet28 Expression Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pet28+expression+vector/pet28a/pmc11070930-722-8-11
Average 90 stars, based on 1 article reviews
Pet28 Expression Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pet28+expression+vector/pet28a/pmc11070930-722-8-11
Average 90 stars, based on 1 article reviews
pet28 expression vector - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Construct:Article Title: Novel modifications of PARP inhibitor veliparib increase PARP1 binding to DNA breaks Article Snippet: The IC 50 values for target compounds against PARP1 enzyme were calculated from a 10-point concentration-response curve using the BPS PARP1 Chemiluminescence Activity Assay Kit (Catalog #80551) (BPS Bioscience). .. The following PARP1 constructs were expressed from a Article Title: Modification of Superoxide Dismutase 1 (SOD1) Properties by a GFP Tag – Implications for Research into Amyotrophic Lateral Sclerosis (ALS) Article Snippet: GFP-tagging was achieved by subcloning SOD1 cDNAs into the vector pAcGFP1-C1 (Clontech) between the EcoRI and SalI restriction sites. .. Constructs were cloned into the Article Title: Blomia tropicalis –Specific TCR Transgenic Th2 Cells Induce Inducible BALT and Severe Asthma in Mice by an IL-4/IL-13–Dependent Mechanism Article Snippet: .. The construct was designed and codon optimized for expression in the E. coli bacteria by the OptimumGene algorithm (GenScript, Piscataway, NJ) and cloned into a Expressing:Article Title: Novel modifications of PARP inhibitor veliparib increase PARP1 binding to DNA breaks Article Snippet: The IC 50 values for target compounds against PARP1 enzyme were calculated from a 10-point concentration-response curve using the BPS PARP1 Chemiluminescence Activity Assay Kit (Catalog #80551) (BPS Bioscience). .. The following PARP1 constructs were expressed from a Article Title: Essential roles of buried phenylalanine in the structural stability of thioredoxin from a psychrophilic Arctic bacterium Sphingomonas sp. Article Snippet: .. The Article Title: Non-protective immune imprint underlies failure of Staphylococcus aureus IsdB vaccine. Article Snippet: .. The PCR product was cloned into Article Title: Modification of Superoxide Dismutase 1 (SOD1) Properties by a GFP Tag – Implications for Research into Amyotrophic Lateral Sclerosis (ALS) Article Snippet: GFP-tagging was achieved by subcloning SOD1 cDNAs into the vector pAcGFP1-C1 (Clontech) between the EcoRI and SalI restriction sites. .. Constructs were cloned into the Article Title: Blomia tropicalis –Specific TCR Transgenic Th2 Cells Induce Inducible BALT and Severe Asthma in Mice by an IL-4/IL-13–Dependent Mechanism Article Snippet: .. The construct was designed and codon optimized for expression in the E. coli bacteria by the OptimumGene algorithm (GenScript, Piscataway, NJ) and cloned into a Article Title: Conformational Disorder Analysis of the Conditionally Disordered Protein CP12 from Arabidopsis thaliana in Its Different Redox States Article Snippet: .. The cDNA coding for the mature form of the isoform 2 of Arabidopsis thaliana CP12 (gene ID At3g62410) was cloned into the Article Title: Duplication and Diversification of the Spermidine/Spermine N 1 -acetyltransferase 1 Genes in Zebrafish Article Snippet: Enzymes used in molecular cloning were obtained from New England Biolabs. .. The pGEX-2T expression vector was from GE Healthcare Bioscience; the pcDNA3.1/myc-His vector was from Invitrogen; the Plasmid Preparation:Article Title: Novel modifications of PARP inhibitor veliparib increase PARP1 binding to DNA breaks Article Snippet: The IC 50 values for target compounds against PARP1 enzyme were calculated from a 10-point concentration-response curve using the BPS PARP1 Chemiluminescence Activity Assay Kit (Catalog #80551) (BPS Bioscience). .. The following PARP1 constructs were expressed from a Article Title: Non-protective immune imprint underlies failure of Staphylococcus aureus IsdB vaccine. Article Snippet: .. The PCR product was cloned into Article Title: Modification of Superoxide Dismutase 1 (SOD1) Properties by a GFP Tag – Implications for Research into Amyotrophic Lateral Sclerosis (ALS) Article Snippet: GFP-tagging was achieved by subcloning SOD1 cDNAs into the vector pAcGFP1-C1 (Clontech) between the EcoRI and SalI restriction sites. .. Constructs were cloned into the Article Title: Blomia tropicalis –Specific TCR Transgenic Th2 Cells Induce Inducible BALT and Severe Asthma in Mice by an IL-4/IL-13–Dependent Mechanism Article Snippet: .. The construct was designed and codon optimized for expression in the E. coli bacteria by the OptimumGene algorithm (GenScript, Piscataway, NJ) and cloned into a other:Article Title: Structural insights into kinetoplastid coronin oligomerization domain and F-actin interaction Article Snippet: The T. brucei Coronin coiled-coil domain was amplified using forward and reverse primers GAATTC TCGCAGTTGTTAGCTCTTGCCTCG and CTCGAG GGCAAGGGCCTTTATCTTTG CGAT containing BamHI and EcoRI restriction sites (Bold) designed manually from T.brucei strain (927/4 GUTat10.1) and L.donovani strain (BPK282A1) and the PCR product ligated with T/A vector pTZ57 R/T (Ins TA cloneTM PCR cloning kit, Fermentas International Inc.) TA clone digested and sub clone into Polymerase Chain Reaction:Article Title: Non-protective immune imprint underlies failure of Staphylococcus aureus IsdB vaccine. Article Snippet: .. The PCR product was cloned into Clone Assay:Article Title: Non-protective immune imprint underlies failure of Staphylococcus aureus IsdB vaccine. Article Snippet: .. The PCR product was cloned into Article Title: Modification of Superoxide Dismutase 1 (SOD1) Properties by a GFP Tag – Implications for Research into Amyotrophic Lateral Sclerosis (ALS) Article Snippet: GFP-tagging was achieved by subcloning SOD1 cDNAs into the vector pAcGFP1-C1 (Clontech) between the EcoRI and SalI restriction sites. .. Constructs were cloned into the Article Title: Blomia tropicalis –Specific TCR Transgenic Th2 Cells Induce Inducible BALT and Severe Asthma in Mice by an IL-4/IL-13–Dependent Mechanism Article Snippet: .. The construct was designed and codon optimized for expression in the E. coli bacteria by the OptimumGene algorithm (GenScript, Piscataway, NJ) and cloned into a Article Title: Conformational Disorder Analysis of the Conditionally Disordered Protein CP12 from Arabidopsis thaliana in Its Different Redox States Article Snippet: .. The cDNA coding for the mature form of the isoform 2 of Arabidopsis thaliana CP12 (gene ID At3g62410) was cloned into the Bacteria:Article Title: Blomia tropicalis –Specific TCR Transgenic Th2 Cells Induce Inducible BALT and Severe Asthma in Mice by an IL-4/IL-13–Dependent Mechanism Article Snippet: .. The construct was designed and codon optimized for expression in the E. coli bacteria by the OptimumGene algorithm (GenScript, Piscataway, NJ) and cloned into a |